14/12/2018, 11:00:19 pm *
Bienvenido(a), Visitante. Por favor, ingresa o regístrate.
¿Perdiste tu email de activación?

Ingresar con nombre de usuario, contraseña y duración de la sesión
Noticias: Renovado el procedimiento de inserción de archivos GEOGEBRA en los mensajes.
 
 
Páginas: [1]   Ir Abajo
  Imprimir  
Autor Tema: ADN software  (Leído 4261 veces)
0 Usuarios y 1 Visitante están viendo este tema.
polop
Nuevo
*

Karma: +0/-0
Desconectado Desconectado

Sexo: Masculino
Argentina Argentina

Mensajes: 3


Ver Perfil
« : 04/08/2010, 09:21:12 pm »

Hola los felicito por tanta belleza junta, mi pregunta es si alguien conoce algun programa que ingresandole dos o mas  secuencias de ADN (....cccagcttctgcagctcggcgatga.....) 4 signos  , detecte series de combinaciones identicas,,,  muchas gracias por el aporte
En línea
mathtruco
Moderador Global
Pleno*
*

Karma: +0/-0
Desconectado Desconectado

Sexo: Masculino
Chile Chile

Mensajes: 4.791

El gran profesor inspira


Ver Perfil
« Respuesta #1 : 05/08/2010, 12:13:34 am »

Hola polop,

 bienvenido al foro.

No sé de un programa que lo haga directamente, pero parece ser muy fácil de programar (en cualquier lenguaje)  --si es que entendí bien lo que necesitas--

¿sabes programar?

Si no, en este foro hay un curso de programación en [texx]C\sharp[/texx], y no es nada del otro mundo. Con eso puedes tener el programa.
En línea
mathtruco
Moderador Global
Pleno*
*

Karma: +0/-0
Desconectado Desconectado

Sexo: Masculino
Chile Chile

Mensajes: 4.791

El gran profesor inspira


Ver Perfil
« Respuesta #2 : 05/08/2010, 07:11:12 pm »

Hola,

 ten en cuenta que acá se sabe de programación y matemática, , pero no de biología. Así que tendrías que explicarnos un poco del tema.

 ¿Las listas son finitas?
 ¿dadas dos listas, hay que encontrar sublistas iguales? ¿de qué largo?

por ejemplo, si se tiene s1=cccagcttctgcagctcggcgatga y s1=ccgtggtacagtgcacc
¿los colores indicarían la solución?

Quizás con un par de ejemplos nos queda claro.

Con respecto al otro punto, primero debes aprender un poco de programación (instalarte el software, y hacer ejemplos sencillos), y luego podrías, por ejemplo, postear la solución (hasta donde llegues), y entre todos te ayudamos.
En línea
polop
Nuevo
*

Karma: +0/-0
Desconectado Desconectado

Sexo: Masculino
Argentina Argentina

Mensajes: 3


Ver Perfil
« Respuesta #3 : 05/08/2010, 08:54:51 pm »

Hola Mathtruco,
supongamos secuencias de 385 posiciones
en cada posición solo un signo que puede tomar 4 valores acgt 
las secuencias de 385 son un subconjunto de una secuencia mayor

me interesan varias cosas,, trabajar con operaciones de identidad, de recurrencia y ritmos , por otra parte llegar a definir la significacion de las diferencias entre dos secuencias


un problema es que la secuencias llegan incompletas (en sus extremos) o sea son de largo variable no aparece ordenado como lo transcribo , sino que las dos series estan defasadas

entonces una primer operacion me parece que es "enfrentar" ambos fragmentos, produciendo corrimientos y contando la cantidad de pares en la misma posicion para cada corrimiento

ejemplo
           a  c  g  g
a  c  g  g                 cero co-incidencia
           a  c  g  g
    a  c  g  g              cero
           a  c  g  g
       a  c  g  g           una
           a  c  g  g
           a  c  g  g       cuatro
           a  c  g  g
               a  c  g  g   una
           a  c  g  g       
                  a  c  g  g cero
           a  c  g  g
                      a  c  g  g   cero

para dos series de largo L1 y L2
la cantidad de encajes posibles seria  L1+L2-2
y el maximo valor daria el encaje adecuado para leer diferencias

entonces quedariamos en una situacion como la siguiente
por ej estos son dos fragmentos de adn uno de BCC spp y el otro de BCC contaminans
ag c gcctgctcgccggtgtccgg t tgcga a atcagcagctccggcacattcacgccgagcttcg

ag t gcctgctcgccggtgtccgg c tgcga g atcagcagctccggcacgttcacgccgagcttcg

donde hay zonas de identidad y zonas de diferencia
hay alguna prueda estadistica que me permita evaluar la significacion de la diferencia entre esos dos fragmentos, mas alla de un calculo tipo casos favorables / casos posibles ??
imagino que va a depender de si considero solo las zonas de diferencia o como un total
gracias por las preguntas me ayudan a pensar


En línea
mathtruco
Moderador Global
Pleno*
*

Karma: +0/-0
Desconectado Desconectado

Sexo: Masculino
Chile Chile

Mensajes: 4.791

El gran profesor inspira


Ver Perfil
« Respuesta #4 : 09/08/2010, 11:27:31 pm »

Me queda un poco más claro el problema. La primera parte que señalas en tu último post (eso de comparar componente a componente dos secuencias de ADN) sigo afirmando que puedes hacer un programa que automatice el proceso.

Para la segunda parte, se me ocurre hacer inferencia sobre la proporción de aciertos. Si la proporción está suficientemente cercana a 1 (con cierto nivel de significancia) podrías inferir algo. Pero estoy medio oxidado en estadística.
En línea
eclipse91
Nuevo
*

Karma: +0/-0
Desconectado Desconectado

Sexo: Femenino
España España

Mensajes: 4


Ver Perfil
« Respuesta #5 : 30/08/2010, 01:08:51 am »

mathtruco tiene razon, eso lo puedes programar, la primera parte
incluso la segunda, no se ve muy complicado realizar comparaciones.
En línea
Páginas: [1]   Ir Arriba
  Imprimir  
 
Ir a:  

Impulsado por MySQL Impulsado por PHP Powered by SMF 1.1.4 | SMF © 2006, Simple Machines LLC XHTML 1.0 válido! CSS válido!